pBEAST-J23101-CocE
(Plasmid #114600)

• Purpose: "Strong constitutive expression of metabolic enzyme, CocE, for cell-free expression"
• Depositing Lab: Jerome Bonnet
• Publication: Voyvodic et al Nat Commun. 2019 Apr 12;10(1):1697. doi: 10.1038/s41467-019-09722-9.

Backbone

• Vector backbone: pBEST-OR2-OR1-Pr-UTR1-deGFP-T500
• Modifications to backbone: Two 40bp spacers were added to the each end of the insert to facilitate Gibson assembly cloning into more complex constructs. Upstream and downstream terminators (B0014 and B0015, respectively) we also added, each flanked by two 40bp spacers. The OR2-OR1-Pr promoter and UTR were replaced with J23101 and B0032, respectively, and deGFP was replaced by CocE.
• Vector type: Synthetic Biology ; Cell-Free Protein Synthesis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CocE
• Species: Rhodococcus sp.
• Insert Size (bp): 1725
• Promoter: J23101

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACTATCGCACCATCAGCCAG
• 3′ sequencing primer: GGCACCTGTCCTACGAGTTG

Resource Information

• Supplemental Documents:
  • pBEAST-J23101-CocE

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry