Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBEAST-pBen-sfGFP
(Plasmid #114598)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114598 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBEST-OR2-OR1-Pr-UTR1-deGFP-T500
  • Modifications to backbone
    Two 40bp spacers were added to the each end of the insert to facilitate Gibson assembly cloning into more complex constructs. Upstream and downstream terminators (B0014 and B0015, respectively) we also added, each flanked by two 40bp spacers. The OR2-OR1-Pr promoter and UTR were replaced by the BenR-activated PBen and its native RBS, and deGFP was replaced by sfGFP.
  • Vector type
    Synthetic Biology ; Cell-Free Protein Synthesis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter PBen

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGCTGAGCTAACACCGTGC
  • 3′ sequencing primer GGCACCTGTCCTACGAGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEAST-pBen-sfGFP was a gift from Jerome Bonnet (Addgene plasmid # 114598 ; http://n2t.net/addgene:114598 ; RRID:Addgene_114598)
  • For your References section:

    Plug-and-play metabolic transducers expand the chemical detection space of cell-free biosensors. Voyvodic PL, Pandi A, Koch M, Conejero I, Valjent E, Courtet P, Renard E, Faulon JL, Bonnet J. Nat Commun. 2019 Apr 12;10(1):1697. doi: 10.1038/s41467-019-09722-9. 10.1038/s41467-019-09722-9 PubMed 30979906