mOtop1_pcDNA3
(Plasmid
#114677)
-
PurposeThis construct was used to express mouse Otop1 in HEK-293 cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114677 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5429
- Total vector size (bp) 7232
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOtopetrin 1
-
Alt nameOtop1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1803
-
MutationSNP (rs49325632): Glycine 396 to Alanine
-
GenBank IDNM_172709
-
Entrez GeneOtop1 (a.k.a. A530025J20Rik, Otp1, tlt)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: mOtop1 contains G396A which is a known mutation/SNP
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mOtop1_pcDNA3 was a gift from Emily Liman (Addgene plasmid # 114677 ; http://n2t.net/addgene:114677 ; RRID:Addgene_114677) -
For your References section:
An evolutionarily conserved gene family encodes proton-selective ion channels. Tu YH, Cooper AJ, Teng B, Chang RB, Artiga DJ, Turner HN, Mulhall EM, Ye W, Smith AD, Liman ER. Science. 2018 Mar 2;359(6379):1047-1050. doi: 10.1126/science.aao3264. Epub 2018 Jan 25. 10.1126/science.aao3264 PubMed 29371428