-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 11478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneRCASBP-Y
- Backbone size w/o insert (bp) 11600
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsDb3.1 cells due to presence of ccdB gene
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGateway ccdB reading frame cassette
-
Insert Size (bp)2200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (destroyed during cloning)
- 3′ cloning site PmeI (destroyed during cloning)
- 5′ sequencing primer gagctgagctgactctgctggtggc
- 3′ sequencing primer cagatacgcgtatatctggc (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RCASBP-Y DV was a gift from William Pavan (Addgene plasmid # 11478 ; http://n2t.net/addgene:11478 ; RRID:Addgene_11478) -
For your References section:
Generation of RCAS vectors useful for functional genomic analyses. Loftus SK, Larson DM, Watkins-Chow D, Church DM, Pavan WJ. DNA Res. 2001 Oct 31. 8(5):221-6. 10.1093/dnares/8.5.221 PubMed 11759842