Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RCASBP-Y NHA-EGFP
(Plasmid #11481)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11481 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    RCASBP-Y
  • Backbone size w/o insert (bp) 11600
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Enhanced Green Fluoresecent Protein
  • Alt name
    EGFP
  • Insert Size (bp)
    680
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site AttB1-gateway (destroyed during cloning)
  • 3′ cloning site attB2- gateway (destroyed during cloning)
  • 5′ sequencing primer gagctgagctgactctgctggtggc
  • 3′ sequencing primer cagatacgcgtatatctggc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PCR amplified from pIRES-eGFP from clontech
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RCASBP-Y NHA-EGFP was a gift from William Pavan (Addgene plasmid # 11481 ; http://n2t.net/addgene:11481 ; RRID:Addgene_11481)
  • For your References section:

    Generation of RCAS vectors useful for functional genomic analyses. Loftus SK, Larson DM, Watkins-Chow D, Church DM, Pavan WJ. DNA Res. 2001 Oct 31. 8(5):221-6. 10.1093/dnares/8.5.221 PubMed 11759842