pLIC.B4.SPy0289
(Plasmid
#11534)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIC.B4
- Backbone size w/o insert (bp) 7313
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIscU
-
SpeciesS. pyogenes
-
Insert Size (bp)477
-
GenBank IDNP_268637 SPy0289
-
Tag
/ Fusion Protein
- HisTag-MBP, TEV cleavable (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer CGTCAGACTGTCGATGAAGCCC
- 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pLIC.B4.SPy0289 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIC.B4.SPy0289 was a gift from Sung-Hou Kim (Addgene plasmid # 11534 ; http://n2t.net/addgene:11534 ; RRID:Addgene_11534) -
For your References section:
Structural characterization of an iron-sulfur cluster assembly protein IscU in a zinc-bound form. Liu J, Oganesyan N, Shin DH, Jancarik J, Yokota H, Kim R, Kim SH. Proteins. 2005 Jun 1. 59(4):875-81. 10.1002/prot.20421 PubMed 15815978