Skip to main content

pHM6g.TM1457
(Plasmid #11540)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11540 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHM6g
  • Backbone size w/o insert (bp) 6520
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TM1457
  • Species
    T. maritima
  • Insert Size (bp)
    282
  • GenBank ID
    AAD36525 TM1457 NP_229256
  • Entrez Gene
    TM1457
  • Tag / Fusion Protein
    • HisTag-MBP, TEV cleavable (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGTCAGACTGTCGATGAAGCCC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the plasmid pHM6g.TM1457 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHM6g.TM1457 was a gift from Sung-Hou Kim (Addgene plasmid # 11540 ; http://n2t.net/addgene:11540 ; RRID:Addgene_11540)
  • For your References section:

    Crystal structure of TM1457 from Thermotoga maritima. Shin DH, Lou Y, Jancarik J, Yokota H, Kim R, Kim SH. J Struct Biol. 2005 Nov . 152(2):113-7. 10.1016/j.jsb.2005.08.008 PubMed 16242963