YIplac211-Sec31-yoHalo
(Plasmid
#115423)
-
PurposeExpress Sec31-yoHalo at the endogenous locus via pop-in pop-out mutagenesis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneYIplac211
- Total vector size (bp) 5918
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSec31-yoHalo
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2089
- Promoter Endogenous
-
Tag
/ Fusion Protein
- yoHaloTag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer CACACAGGAAACAGCTATGACCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIplac211-Sec31-yoHalo was a gift from Benjamin Glick (Addgene plasmid # 115423 ; http://n2t.net/addgene:115423 ; RRID:Addgene_115423) -
For your References section:
Maturation-driven transport and AP-1-dependent recycling of a secretory cargo in the Golgi. Casler JC, Papanikou E, Barrero JJ, Glick BS. J Cell Biol. 2019 May 6;218(5):1582-1601. doi: 10.1083/jcb.201807195. Epub 2019 Mar 11. 10.1083/jcb.201807195 PubMed 30858194