Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pXPR_BRD003-sgQKI-2201
(Plasmid #115449)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115449 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXPR_BRD003
  • Backbone manufacturer
    Broad Institute - Genetic Perturbation Platform
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgQKI-2201
  • gRNA/shRNA sequence
    GGATGTAAAATCATGGTCCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    QKI (a.k.a. Hqk, QK, QK1, QK3, hqkI)

Cloning Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_BRD003-sgQKI-2201 was a gift from William Hahn (Addgene plasmid # 115449 ; http://n2t.net/addgene:115449 ; RRID:Addgene_115449)
  • For your References section:

    An alternative splicing switch in FLNB promotes the mesenchymal cell state in human breast cancer. Li J, Choi PS, Chaffer CL, Labella K, Hwang JH, Giacomelli AO, Kim JW, Ilic N, Doench JG, Ly SH, Dai C, Hagel K, Hong AL, Gjoerup O, Goel S, Ge JY, Root DE, Zhao JJ, Brooks AN, Weinberg RA, Hahn WC. Elife. 2018 Jul 30;7. pii: 37184. doi: 10.7554/eLife.37184. 37184 [pii] PubMed 30059005