AAVS1-TRE3G-NODAL
(Plasmid
#115638)
-
PurposeFor targeted integration and inducible expression of human NODAL using doxycycline
-
Depositing Lab
-
Depositing OrganizationUniversity of Alberta
Located in Canada -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAVS1-TRE3G
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan be grown at 37°C in TOP10 E. coli.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNODAL
-
SpeciesH. sapiens (human)
-
Entrez GeneNODAL (a.k.a. HTX5)
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TRE3G (GATCGCCTGGAGCAATTCCAC)
- 3′ sequencing primer SV40pA-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use with TALENs #52341 and #52342. Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TRE3G-NODAL was a gift from Lynne Postovit (Addgene plasmid # 115638 ; http://n2t.net/addgene:115638 ; RRID:Addgene_115638) -
For your References section:
Genetically regulated human NODAL splice variants are differentially post-transcriptionally processed and functionally distinct. Findlay SD, Bilyk O, Lypka K, Waskiewicz AJ, Postovit L. (2018) bioRxiv 276170 10.1101/276170