Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAVS1-TRE3G-NODAL
(Plasmid #115638)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115638 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can be grown at 37°C in TOP10 E. coli.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NODAL
  • Species
    H. sapiens (human)
  • Entrez Gene
    NODAL (a.k.a. HTX5)
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TRE3G (GATCGCCTGGAGCAATTCCAC)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use with TALENs #52341 and #52342. Please visit https://www.biorxiv.org/content/early/2018/03/04/276170 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-TRE3G-NODAL was a gift from Lynne Postovit (Addgene plasmid # 115638 ; http://n2t.net/addgene:115638 ; RRID:Addgene_115638)
  • For your References section:

    Genetically regulated human NODAL splice variants are differentially post-transcriptionally processed and functionally distinct. Findlay SD, Bilyk O, Lypka K, Waskiewicz AJ, Postovit L. (2018) bioRxiv 276170 10.1101/276170