pKEW106-MbCas12a-58069
(Plasmid
#115653)
-
PurposeExpresses MbCas12a in bacteria from M. bovoculi strain 58069, under TetR control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115653 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCmR/p15A
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 6354
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMbCas12a
-
Alt nameMbCpf1
-
SpeciesMoraxella bovoculi
-
Insert Size (bp)3756
-
GenBank IDWP_046700744.1
- Promoter Ptet
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tacacctagcttctgggcgagtttacg
- 3′ sequencing primer gtgagcgaggaagcggaatatatcc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKEW106-MbCas12a-58069 was a gift from Jennifer Doudna (Addgene plasmid # 115653 ; http://n2t.net/addgene:115653 ; RRID:Addgene_115653) -
For your References section:
Systematic discovery of natural CRISPR-Cas12a inhibitors. Watters KE, Fellmann C, Bai HB, Ren SM, Doudna JA. Science. 2018 Oct 12;362(6411):236-239. doi: 10.1126/science.aau5138. Epub 2018 Sep 6. 10.1126/science.aau5138 PubMed 30190307