pTSSX-STC
(Plasmid
#115668)
-
PurposeE.coli expression plasmid of small tetraheme cytochrome (STC) from Shewanella oneidensis MR-1 with cleavable Strep tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTSSX
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesmall tetraheme cytochrome c
-
Alt nameSTC
-
Alt nameCctA
-
SpeciesShewanella oneidensis MR-1
-
Insert Size (bp)393
-
GenBank IDNP_718311
- Promoter tac
-
Tag
/ Fusion Protein
- Signal peptide (aa1-27)-Strep-II tag- Factor Xa cleavage site (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTCTGGCAAATATTCTGAAATGAG
- 3′ sequencing primer CAAATGCCTGAGGTTTCAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSSX-STC was a gift from David Kramer (Addgene plasmid # 115668 ; http://n2t.net/addgene:115668 ; RRID:Addgene_115668) -
For your References section:
Mesoscopic to Macroscopic Electron Transfer by Hopping in a Crystal Network of Cytochromes. Huang J, Zarzycki J, Gunner MR, Parson WW, Kern JF, Yano J, Ducat DC, Kramer DM. J Am Chem Soc. 2020 Jun 10;142(23):10459-10467. doi: 10.1021/jacs.0c02729. Epub 2020 May 29. 10.1021/jacs.0c02729 PubMed 32406683