-
PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSimpleII
- Backbone size w/o insert (bp) 5693
- Total vector size (bp) 8936
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Insect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameNmeCas9
-
SpeciesNeisseria meningitidis, strain 8013
-
Insert Size (bp)3243
-
MutationNone
-
GenBank IDFM999788.1 19818133
- Promoter EF-1 alpha
-
Tags
/ Fusion Proteins
- NLS, HA (C terminal on insert)
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gctgccttcaaacctaattcaatcaactacatcctc
- 3′ sequencing primer acggacaggcgggcgttttttca
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNme-sgRNA
-
SpeciesNeisseria meningitidis, strain 8013
-
Insert Size (bp)156
-
Mutationfusion of repeat/tracrRNA to make a sgRNA
-
GenBank IDFM999788.1
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gagcagatactggcttaactatg
- 3′ sequencing primer aaataaacaaataggggttccgc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS was a gift from Erik Sontheimer (Addgene plasmid # 115694 ; http://n2t.net/addgene:115694 ; RRID:Addgene_115694) -
For your References section:
NmeCas9 is an intrinsically high-fidelity genome-editing platform. Amrani N, Gao XD, Liu P, Edraki A, Mir A, Ibraheim R, Gupta A, Sasaki KE, Wu T, Donohoue PD, Settle AH, Lied AM, McGovern K, Fuller CK, Cameron P, Fazzio TG, Zhu LJ, Wolfe SA, Sontheimer EJ. Genome Biol. 2018 Dec 5;19(1):214. doi: 10.1186/s13059-018-1591-1. 10.1186/s13059-018-1591-1 PubMed 30518407