pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
(Plasmid #115694)

• Purpose: All-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.
• Depositing Lab: Erik Sontheimer
• Depositing Organization: University of Massachusetts, Worcester
  Located in United States of America
• Publication: Amrani et al Genome Biol. 2018 Dec 5;19(1):214. doi: 10.1186/s13059-018-1591-1.
• Citations: 1 Article

Backbone

• Vector backbone: pSimpleII
• Backbone size w/o insert (bp): 5693
• Total vector size (bp): 8936
• Modifications to backbone: None
• Vector type: Mammalian Expression, Insect Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: NmeCas9
• Species: Neisseria meningitidis, strain 8013
• Insert Size (bp): 3243
• Mutation: None
• GenBank ID: FM999788.1 19818133
• Promoter: EF-1 alpha
• Tags / Fusion Proteins:
  • NLS, HA (C terminal on insert)
  • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gctgccttcaaacctaattcaatcaactacatcctc
• 3′ sequencing primer: acggacaggcgggcgttttttca

Gene/Insert 2

• Gene/Insert name: Nme-sgRNA
• Species: Neisseria meningitidis, strain 8013
• Insert Size (bp): 156
• Mutation: fusion of repeat/tracrRNA to make a sgRNA
• GenBank ID: FM999788.1
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagcagatactggcttaactatg
• 3′ sequencing primer: aaataaacaaataggggttccgc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 115694-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 115694-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.