Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
(Plasmid #115694)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115694 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSimpleII
  • Backbone size w/o insert (bp) 5693
  • Total vector size (bp) 8936
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    NmeCas9
  • Species
    Neisseria meningitidis, strain 8013
  • Insert Size (bp)
    3243
  • Mutation
    None
  • GenBank ID
    FM999788.1 19818133
  • Promoter EF-1 alpha
  • Tags / Fusion Proteins
    • NLS, HA (C terminal on insert)
    • NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gctgccttcaaacctaattcaatcaactacatcctc
  • 3′ sequencing primer acggacaggcgggcgttttttca
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Nme-sgRNA
  • Species
    Neisseria meningitidis, strain 8013
  • Insert Size (bp)
    156
  • Mutation
    fusion of repeat/tracrRNA to make a sgRNA
  • GenBank ID
    FM999788.1
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagcagatactggcttaactatg
  • 3′ sequencing primer aaataaacaaataggggttccgc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS was a gift from Erik Sontheimer (Addgene plasmid # 115694 ; http://n2t.net/addgene:115694 ; RRID:Addgene_115694)
  • For your References section:

    NmeCas9 is an intrinsically high-fidelity genome editing platform. Nadia Amrani; Xin D. Gao; Pengpeng Liu; Alireza Edraki; Aamir Mir; Raed Ibraheim; Ankit Gupta; Kanae E. Sasaki; Tong Wu; Paul D. Donohoue; Alexander H. Settle; Alexandra M. Lied; Kyle McGovern; Chris K. Fuller; Peter Cameron; Thomas G. Fazzio; Lihua Julie Zhu; Scot A. Wolfe; Erik Sontheimer. Genome Biology