Skip to main content

pAPM-D4- miR30-L1221
(Plasmid #115846)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115846 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAPM-D4-mir30
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    control shRNA
  • gRNA/shRNA sequence
    CTTGTCGATGAGAGCGTTTGT
  • Species
    H. sapiens (human)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PuroR . Please visit https://www.biorxiv.org/content/early/2018/04/03/293001 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAPM-D4- miR30-L1221 was a gift from Jeremy Luban (Addgene plasmid # 115846 ; http://n2t.net/addgene:115846 ; RRID:Addgene_115846)
  • For your References section:

    Primate immunodeficiency virus proteins Vpx and Vpr counteract transcriptional repression of proviruses by the HUSH complex. Yurkovetskiy L, Guney MH, Kim K, Goh SL, McCauley S, Dauphin A, Diehl WE, Luban J. Nat Microbiol. 2018 Dec;3(12):1354-1361. doi: 10.1038/s41564-018-0256-x. Epub 2018 Oct 8. 10.1038/s41564-018-0256-x PubMed 30297740