pMJA284= pSin-Pur-MCS-Puro
(Plasmid
#116877)
-
Purpose(Empty Backbone) Lentiviral transfer vector containing a multible cloning site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 116877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSin-EF2-Nanog-Pur
-
Backbone manufacturerJames Thomson Lab
- Backbone size (bp) 8507
-
Modifications to backbonedeleted EF1-alpha promotor, added a MCS
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer MJA 424 5’TTGCGTGCCTTGAATTACTTCCACCT
- 3′ sequencing primer MJA 425 5’AATAAGGCCGGTGTGCGTTTGTCTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRonja Pscheid, Rui Wang, Marcos Alcocer
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The psPAX2 packaging plasmid and pMD2.G envelope plasmid can be used with this vector.
GeneBank ID:MH782474
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA284= pSin-Pur-MCS-Puro was a gift from Marcos Alcocer (Addgene plasmid # 116877 ; http://n2t.net/addgene:116877 ; RRID:Addgene_116877) -
For your References section:
Towards a surrogate system to express human lipid binding TCRs. Wang R, Pscheid R, Ghumra A, Kan LYL, Cochrane S, Fairclough L, Alcocer MJC. Biotechnol Lett. 2019 Oct;41(10):1095-1104. doi: 10.1007/s10529-019-02713-2. Epub 2019 Jul 26. 10.1007/s10529-019-02713-2 PubMed 31346817