Skip to main content

pMJA284= pSin-Pur-MCS-Puro
(Plasmid #116877)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 116877 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSin-EF2-Nanog-Pur
  • Backbone manufacturer
    James Thomson Lab
  • Backbone size (bp) 8507
  • Modifications to backbone
    deleted EF1-alpha promotor, added a MCS
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer MJA 424 5’TTGCGTGCCTTGAATTACTTCCACCT
  • 3′ sequencing primer MJA 425 5’AATAAGGCCGGTGTGCGTTTGTCTAT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Ronja Pscheid, Rui Wang, Marcos Alcocer
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The psPAX2 packaging plasmid and pMD2.G envelope plasmid can be used with this vector.
GeneBank ID:MH782474

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJA284= pSin-Pur-MCS-Puro was a gift from Marcos Alcocer (Addgene plasmid # 116877 ; http://n2t.net/addgene:116877 ; RRID:Addgene_116877)
  • For your References section:

    Towards a surrogate system to express human lipid binding TCRs. Wang R, Pscheid R, Ghumra A, Kan LYL, Cochrane S, Fairclough L, Alcocer MJC. Biotechnol Lett. 2019 Oct;41(10):1095-1104. doi: 10.1007/s10529-019-02713-2. Epub 2019 Jul 26. 10.1007/s10529-019-02713-2 PubMed 31346817