-
PurposeMammalian vector for expression of the 40nm GEM
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 116933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5344
- Total vector size (bp) 7159
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePfv
-
SpeciesPyrococcus furiosus
-
Insert Size (bp)1035
-
GenBank IDAB214633.1
- Promoter CMV
-
Tag
/ Fusion Protein
- Sapphire (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCGCCCCATTGACGCAAAT
- 3′ sequencing primer GGAGGGGCAAACAACAGAT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.1-pCMV-PfV-GS-Sapphire was a gift from Liam Holt (Addgene plasmid # 116933 ; http://n2t.net/addgene:116933 ; RRID:Addgene_116933) -
For your References section:
mTORC1 Controls Phase Separation and the Biophysical Properties of the Cytoplasm by Tuning Crowding. Delarue M, Brittingham GP, Pfeffer S, Surovtsev IV, Pinglay S, Kennedy KJ, Schaffer M, Gutierrez JI, Sang D, Poterewicz G, Chung JK, Plitzko JM, Groves JT, Jacobs-Wagner C, Engel BD, Holt LJ. Cell. 2018 Jul 12;174(2):338-349.e20. doi: 10.1016/j.cell.2018.05.042. Epub 2018 Jun 21. 10.1016/j.cell.2018.05.042 PubMed 29937223