-
PurposeExpresses human MCM4 and human MCM6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 116951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDFDuet-1
- Total vector size (bp) 8757
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHuman MCM6
-
Alt nameminichromosome maintenance 6
-
Alt nameDNA replication licensing factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2507
-
GenBank IDNP_005906.2
-
Entrez GeneMCM6 (a.k.a. MCG40308, Mis5, P105MCM)
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gacgacgacaagatggacctcgcggcggcagcgg
- 3′ sequencing primer cgcgggcggccgtcaatcttcgagcaagtagttaggg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHuman MCM4
-
Alt nameminichromosome maintenance 4
-
Alt nameDNA replication licensing factor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2612
-
Entrez GeneMCM4 (a.k.a. CDC21, CDC54, IMD54, NKCD, NKGCD, P1-CDC21, hCdc21)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gcgggcccggccttcatgtcgtccccggcgtcgacccc
- 3′ sequencing primer gaggagaagcccggtcagagcaagcgcacggtcttccc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJuan Mendez, CSIC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that mutation L657M in human MCM4 was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF-MCM4/6 was a gift from James Chong (Addgene plasmid # 116951 ; http://n2t.net/addgene:116951 ; RRID:Addgene_116951) -
For your References section:
DNA induces conformational changes in a recombinant human minichromosome maintenance complex. Hesketh EL, Parker-Manuel RP, Chaban Y, Satti R, Coverley D, Orlova EV, Chong JP. J Biol Chem. 2015 Mar 20;290(12):7973-9. doi: 10.1074/jbc.M114.622738. Epub 2015 Feb 3. 10.1074/jbc.M114.622738 PubMed 25648893