Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCDF-MCM4/6
(Plasmid #116951)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 116951 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDFDuet-1
  • Total vector size (bp) 8757
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Human MCM6
  • Alt name
    minichromosome maintenance 6
  • Alt name
    DNA replication licensing factor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2507
  • GenBank ID
    NP_005906.2
  • Entrez Gene
    MCM6 (a.k.a. MCG40308, Mis5, P105MCM)
  • Tag / Fusion Protein
    • His6 (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gacgacgacaagatggacctcgcggcggcagcgg
  • 3′ sequencing primer cgcgggcggccgtcaatcttcgagcaagtagttaggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Human MCM4
  • Alt name
    minichromosome maintenance 4
  • Alt name
    DNA replication licensing factor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2612
  • Entrez Gene
    MCM4 (a.k.a. CDC21, CDC54, IMD54, NKCD, NKGCD, P1-CDC21, hCdc21)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gcgggcccggccttcatgtcgtccccggcgtcgacccc
  • 3′ sequencing primer gaggagaagcccggtcagagcaagcgcacggtcttccc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Juan Mendez, CSIC

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that mutation L657M in human MCM4 was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF-MCM4/6 was a gift from James Chong (Addgene plasmid # 116951 ; http://n2t.net/addgene:116951 ; RRID:Addgene_116951)
  • For your References section:

    DNA induces conformational changes in a recombinant human minichromosome maintenance complex. Hesketh EL, Parker-Manuel RP, Chaban Y, Satti R, Coverley D, Orlova EV, Chong JP. J Biol Chem. 2015 Mar 20;290(12):7973-9. doi: 10.1074/jbc.M114.622738. Epub 2015 Feb 3. 10.1074/jbc.M114.622738 PubMed 25648893