pXPR_BRD003 PSMB5 guide 1
(Plasmid
#117073)
-
Purposesingle guide RNA targeting PSMB5; guide 1
-
Depositing Lab
-
Depositing OrganizationDana-Farber Cancer Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 117073-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 117073-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepXPR_BRD003
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 8318
- Total vector size (bp) 8318
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLMPX
-
gRNA/shRNA sequenceTCTACTACGTGGACAGTGAA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_002797.4 NM_002797.4
-
Entrez GenePSMB5 (a.k.a. LMPX, MB1)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 117073-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 117073-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_BRD003 PSMB5 guide 1 was a gift from William Hahn (Addgene plasmid # 117073 ; http://n2t.net/addgene:117073 ; RRID:Addgene_117073) -
For your References section:
Renal medullary carcinomas depend upon SMARCB1 loss and are sensitive to proteasome inhibition. Hong AL, Tseng YY, Wala JA, Kim WJ, Kynnap BD, Doshi MB, Kugener G, Sandoval GJ, Howard TP, Li J, Yang X, Tillgren M, Ghandi M, Sayeed A, Deasy R, Ward A, McSteen B, Labella KM, Keskula P, Tracy A, Connor C, Clinton CM, Church AJ, Crompton BD, Janeway KA, Van Hare B, Sandak D, Gjoerup O, Bandopadhayay P, Clemons PA, Schreiber SL, Root DE, Gokhale PC, Chi SN, Mullen EA, Roberts CW, Kadoch C, Beroukhim R, Ligon KL, Boehm JS, Hahn WC. Elife. 2019 Mar 12;8. pii: 44161. doi: 10.7554/eLife.44161. 10.7554/eLife.44161 PubMed 30860482
