Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSpCas9 (PX165)
(Plasmid #48137)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48137 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hSpCas9
  • Alt name
    SpCas9
  • Alt name
    Cas9
  • Alt name
    PX165
  • Species
    Synthetic
  • Insert Size (bp)
    5400
  • Promoter Cbh
  • Tag / Fusion Protein
    • 3XFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGGAGCACCTGCCTGAAATCACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9 (PX165) was a gift from Feng Zhang (Addgene plasmid # 48137 ; http://n2t.net/addgene:48137 ; RRID:Addgene_48137)
  • For your References section:

    Genome engineering using the CRISPR-Cas9 system. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. 10.1038/nprot.2013.143 PubMed 24157548