pET-Gate2 ccdB
(Plasmid
#117116)
-
Purpose(Empty Backbone) Destination vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117116 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-Gate2
- Backbone size (bp) 6000
-
Vector typeBackbone for Golden gate assembly for gene targeting in Bacillus subtilis
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ATGCTAGTTATTGCTCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Backbone vector for reconstitution of gene targeting constructs by Golden gate assembly. Overhangs generated upon BsaI cleavage : CGAG (RU) and CCAT (RD).
(Gruber lab reference pSG436)
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Gate2 ccdB was a gift from Stephan Gruber (Addgene plasmid # 117116 ; http://n2t.net/addgene:117116 ; RRID:Addgene_117116) -
For your References section:
High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909
Map uploaded by the depositor.
