Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET-Gate2 ccdB
(Plasmid #117116)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117116 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET-Gate2
  • Backbone size (bp) 6000
  • Vector type
    Backbone for Golden gate assembly for gene targeting in Bacillus subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer ATGCTAGTTATTGCTCAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Backbone vector for reconstitution of gene targeting constructs by Golden gate assembly. Overhangs generated upon BsaI cleavage : CGAG (RU) and CCAT (RD).

(Gruber lab reference pSG436)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-Gate2 ccdB was a gift from Stephan Gruber (Addgene plasmid # 117116 ; http://n2t.net/addgene:117116 ; RRID:Addgene_117116)
  • For your References section:

    High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909