Skip to main content

pJet1.2 cat cassette
(Plasmid #117119)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117119 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    Thermo scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 4010
  • Vector type
    Golden gate donor vector for gene targeting in Bacillus subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chloramphenicol resistance cassette for Bacillus subtilis selection
  • Species
    Bacillus subtilis
  • Insert Size (bp)
    4000

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Donor vector that encodes for a Chloramphenicol selection marker for Golden gate assembly reactions. Overhangs generated upon BsaI cleavage : AATA (Rup) and TCTA (Rdo).

(Gruber lab reference pSG408)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJet1.2 cat cassette was a gift from Stephan Gruber (Addgene plasmid # 117119 ; http://n2t.net/addgene:117119 ; RRID:Addgene_117119)
  • For your References section:

    High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909