Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJet1.2 Pk6-tag
(Plasmid #117127)


Item Catalog # Description Quantity Price (USD)
Plasmid 117127 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Thermo scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 3226
  • Vector type
    Golden gate donor vector for gene targeting in Bacillus subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    6xPK tag
  • Alt name
    V5 epitope tag
  • Insert Size (bp)
  • GenBank ID
  • Tag / Fusion Protein
    • 6xPK tag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Donor vector for Golden gate assembly reactions that encodes for a C-terminal 6xPK tag (V5). Overhangs generated upon BsaI cleavage : AGCG (RtagN) and TAAG (RtagC).

(Gruber lab reference pSG1107)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJet1.2 Pk6-tag was a gift from Stephan Gruber (Addgene plasmid # 117127 ; ; RRID:Addgene_117127)
  • For your References section:

    High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909