pJet1.2 'rncS
(Plasmid
#117129)
-
Purposesmc gene upstream homology region
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermo scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 3607
-
Vector typeGolden gate donor vector for gene targeting in Bacillus subtilis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name'rncS
-
SpeciesBacillus subtilis
-
Insert Size (bp)600
-
GenBank ID
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Donor vector for Golden gate assembly reactions that encodes the upstream homology region of the smc gene from Bacillus subtilis. Overhangs generated upon BsaI cleavage : CGAG (RU) and TTCC.
(Gruber lab reference pSG1745)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJet1.2 'rncS was a gift from Stephan Gruber (Addgene plasmid # 117129 ; http://n2t.net/addgene:117129 ; RRID:Addgene_117129) -
For your References section:
High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909