Skip to main content

pALPS puro miR30-TAK1
(Plasmid #117162)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117162 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pALPS
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA targeting miR30
  • gRNA/shRNA sequence
    GCGCCTTTGGAGTTGTTTGCAAA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pALPS puro miR30-TAK1 was a gift from Jeremy Luban (Addgene plasmid # 117162 ; http://n2t.net/addgene:117162 ; RRID:Addgene_117162)
  • For your References section:

    Intron-containing RNA from the HIV-1 provirus activates type I interferon and inflammatory cytokines. McCauley SM, Kim K, Nowosielska A, Dauphin A, Yurkovetskiy L, Diehl WE, Luban J. Nat Commun. 2018 Dec 13;9(1):5305. doi: 10.1038/s41467-018-07753-2. 10.1038/s41467-018-07753-2 PubMed 30546110