Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Intron-containing RNA from the HIV-1 provirus activates type I interferon and inflammatory cytokines.
McCauley SM, Kim K, Nowosielska A, Dauphin A, Yurkovetskiy L, Diehl WE, Luban J
Nat Commun. 2018 Dec 13;9(1):5305. doi: 10.1038/s41467-018-07753-2.
PubMed Article

Plasmids from Article

ID Plasmid Purpose  
74168pAIP hGMCSF coLentiviral vector for expression of human codon optimized GMCSF with puromycin resistance.
Loading...
74169pAIP hIL4 coLentiviral vector for expression of human codon optimized IL4 with puromycin resistance.
Loading...
90513pAIP hIL2 coLentiviral vector for expression of human codon optimized IL2 with puromycin resistance.
Loading...
101323pALPS eGFPEncodes eGFP
Loading...
101324pALPS gagEncodes codon optimized NL4-3 gag
Loading...
101325pALPS envEncodes codon optimized JR-CSF env
Loading...
101326pALPS tatEncodes codon optimized NL4-3 tat
Loading...
101327pALPS revEncodes codon optimized NL4-3 rev
Loading...
101328pALPS vifEncodes codon optimized NL4-3 vif
Loading...
101329pALPS vprEncodes codon optimized NL4-3 vpr
Loading...
101330pALPS vpuEncodes codon optimized NL4-3 vpu
Loading...
101331pALPS tat-P2A-revLentivector expressing codon optimized NL4-3 tat and rev linked by P2A peptide coding sequence (GSGATNFSLLKQAGDVEENPGP)
Loading...
101332pBS NL4-3 envFS eGFP RT-D185K/D186LpBS NL4-3 envFS eGFP with mutation that disrupts RT catalytic activity
Loading...
101333pBS NL4-3 envFS eGFP IN-D116ApBS NL4-3 envFS eGFP with mutation that disrupts IN catalytic activity
Loading...
101334pBS NL4-3 envFS eGFP PR-D25ApBS NL4-3 envFS eGFP with mutation that disrupts Protease catalytic activity
Loading...
101335pALPS puro miR30-L1221negative control for knockdowns target site: CTTGTCGATGAGAGCGTTTGT
Loading...
101336pALPS puro miR30-IRF3target site ATCAGATCTACAATGAAGGGC
Loading...
101337pALPS_3'LTR [email protected] start SFFV-Repaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted.
Loading...
101338pALPS_3'LTR [email protected] start SFFV tatLTR drives GFP and internal SFFV promoter drives codon optimized tat
Loading...
101339pALPS_3'LTR [email protected] start SFFV revLTR drives GFP and internal SFFV promoter drives codon optimized rev
Loading...
101340pALPS_3'LTR [email protected] start SFFV tat-P2A-revLTR drives GFP and internal SFFV promoter drives codon optimized tat and rev.
Loading...
101341pNL4-3 envFS eGFP gag2xFS1st frameshift is CG nucleotide insertion in MA at nt 832. 2nd is a CTAG addition in CA at nt 1508.
Loading...
101342pNL4-3 envFS eGFP NoStartsAll ATGs from the start of gag to NC mutated to ATC except the first which was mutated to ACG
Loading...
101343pBS NL4-3 envFS eGFP Δgag/polDeletion from the start of gag until 229 bases before the cPPT
Loading...
101344pNL4-3 envFS eGFP Δvif/vprDeletion from NL4-3 nt 5582-6199 encompassing Vif and Vpr coding sequence
Loading...
101345pNL4-3 envFS eGFP Δvpu/envDeletion from NL4-3 nt 6054-7489 encompassing all of vpu and env until before the RRE
Loading...
101346pBS NL4-3 envFS eGFP Δnef/U3Deletion from NL4-3 nt 8911-9022 and 9088-9377. This deletes nef and U3 LTR sequences
Loading...
101347pBS NL4-3 envFS eGFP 5'CMV Δtattat ATG->ACG (silent in vpr reading frame), nt 78 mutated T->G to change Tyr to stop codon, nt 116 mutated T->C to disrupt Met, 5'LTR replaced with CMV-R-U5 from pALPS for tat-independent transcription in HEK293E cells.
Loading...
101348pBS NL4-3 envFS eGFP ΔrevAll mutations in rev are silent with respect to the tat reading frame. Start ATG->ACG and nts 68-71 were mutated AGC->TCA to change tyrosine to a stop.
Loading...
101349pBS NL4-3 envFS eGFP 5'CMV Δtat ΔTARx2_d2TetOp2xTet Operator inserted between NFkB and Sp1 sites in U3 of HIV-1 delta tat with 5' CMV-R-U5. 5' and 3' TAR elements were mutated to: 5'-GGTCTCTCTGGTTAGACCAGAAAGGAGCATTGGAGCTCTCTGGCTAACTAGGGAACCC-3
Loading...
101350pALPS rtTA3_V14Codon optimized rtTA3 used in trans with Tet inducible HIV-1
Loading...
101351pSC101 NL4-3 envFS Δrev ΔRRE RTEm26CTEHIV-1 delta Rev was cloned into pSC101 and modified to include an RTEm26CTE element in order to utilize the NXF1 RNA export pathway. The RRE was also mutated.
Loading...
117156pALPS puro miR30-IRF1Target site TTGCTCTTAGCATCTCGGCTG
Loading...
117157pALPS puro miR30-IRF5Target site TATTTCCCTGTCTCCTTGGCC
Loading...
117158pALPS puro miR30-IRF7Target site ATAAGGAAGCACTCGATGTCG
Loading...
117159pALPS puro miR30-IRF9Target site AATTATCACAAAGAGGACAGG
Loading...
117160pALPS puro miR30-STAT1Target site ATATCCAGTTCCTTTAGGGCC
Loading...
117161pALPS puro miR30-STAT2Target site TTTAAGTTCCACAGACTTGGA
Loading...
117162pALPS puro miR30-TAK1Target site AGCGCCCTTCAATGGAGGAAAT
Loading...