Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pALPS puro miR30-IRF1
(Plasmid #117156)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117156 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pALPS
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA targeting miR30
  • gRNA/shRNA sequence
    TTGCTCTTAGCATCTCGGCTG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pALPS puro miR30-IRF1 was a gift from Jeremy Luban (Addgene plasmid # 117156 ; http://n2t.net/addgene:117156 ; RRID:Addgene_117156)
  • For your References section:

    Intron-containing RNA from the HIV-1 provirus activates type I interferon and inflammatory cytokines. McCauley SM, Kim K, Nowosielska A, Dauphin A, Yurkovetskiy L, Diehl WE, Luban J. Nat Commun. 2018 Dec 13;9(1):5305. doi: 10.1038/s41467-018-07753-2. 10.1038/s41467-018-07753-2 PubMed 30546110