pALPS puro miR30-IRF3
(Plasmid
#101336)
-
Purposetarget site ATCAGATCTACAATGAAGGGC
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepALPS
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA targeting miR30
-
gRNA/shRNA sequenceATCAGATCTACAATGAAGGGC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pALPS puro miR30-IRF3 was a gift from Jeremy Luban (Addgene plasmid # 101336 ; http://n2t.net/addgene:101336 ; RRID:Addgene_101336) -
For your References section:
Intron-containing RNA from the HIV-1 provirus activates type I interferon and inflammatory cytokines. McCauley SM, Kim K, Nowosielska A, Dauphin A, Yurkovetskiy L, Diehl WE, Luban J. Nat Commun. 2018 Dec 13;9(1):5305. doi: 10.1038/s41467-018-07753-2. 10.1038/s41467-018-07753-2 PubMed 30546110