Anep8_Cas9
(Plasmid
#117169)
-
Purpose(Empty Backbone) Expressed Cas9 in Aspergillus with LIC tags for easy gRNA cloning
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneANEp8
-
Backbone manufacturerStorms et al, 2005
- Backbone size (bp) 11432
-
Modifications to backboneInsertion of Cas9 gene
-
Vector typeCRISPR, Synthetic Biology ; Filamentous fungi expression
- Promoter Pki
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrowth at 30 C for clones isolation
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCAGAATTTAATTAAATGGACAAGAAGTACTCCATTGGG
- 3′ sequencing primer GCAGAATGGCCGGCCTTACACCTTCCTCTTCTTCTTGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Anep8_Cas9 was a gift from Adrian Tsang (Addgene plasmid # 117169 ; http://n2t.net/addgene:117169 ; RRID:Addgene_117169) -
For your References section:
Efficient genome editing using tRNA promoter-driven CRISPR/Cas9 gRNA in Aspergillus niger. Song L, Ouedraogo JP, Kolbusz M, Nguyen TTM, Tsang A. PLoS One. 2018 Aug 24;13(8):e0202868. doi: 10.1371/journal.pone.0202868. eCollection 2018. PONE-D-18-15818 [pii] PubMed 30142205