Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBC2102-reci
(Plasmid #117171)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117171 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Lenti
  • Backbone size w/o insert (bp) 8855
  • Total vector size (bp) 12956
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    reci_wtCas9 without NLS
  • Promoter U6 Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)
  • 5′ sequencing primer gtgacgtagaaagtaataatttcttggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBC2102-reci was a gift from David Savage (Addgene plasmid # 117171 ; http://n2t.net/addgene:117171 ; RRID:Addgene_117171)
  • For your References section:

    Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch. Oakes BL, Nadler DC, Flamholz A, Fellmann C, Staahl BT, Doudna JA, Savage DF. Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3528. 10.1038/nbt.3528 PubMed 27136077