pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
(Plasmid
#117384)
-
PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectively
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5352
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site atgggttctcatcatc (unknown if destroyed)
- 3′ cloning site tgatgacagcgaagtga (unknown if destroyed)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS was a gift from Viviana Gradinaru (Addgene plasmid # 117384 ; http://n2t.net/addgene:117384 ; RRID:Addgene_117384) -
For your References section:
Systemic AAV vectors for widespread and targeted gene delivery in rodents. Challis RC, Ravindra Kumar S, Chan KY, Challis C, Beadle K, Jang MJ, Kim HM, Rajendran PS, Tompkins JD, Shivkumar K, Deverman BE, Gradinaru V. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3. 10.1038/s41596-018-0097-3 PubMed 30626963