Skip to main content

pMRXIP TMEM41B-GFP
(Plasmid #117414)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117414 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMRXIP
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TMEM41B
  • Species
    H. sapiens (human)
  • Entrez Gene
    TMEM41B
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GGCATCGCAGCTTGGATACACGCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRXIP TMEM41B-GFP was a gift from Noboru Mizushima (Addgene plasmid # 117414 ; http://n2t.net/addgene:117414 ; RRID:Addgene_117414)
  • For your References section:

    Genome-wide CRISPR screen identifies TMEM41B as a gene required for autophagosome formation. Morita K, Hama Y, Izume T, Tamura N, Ueno T, Yamashita Y, Sakamaki Y, Mimura K, Morishita H, Shihoya W, Nureki O, Mano H, Mizushima N. J Cell Biol. 2018 Aug 9. pii: jcb.201804132. doi: 10.1083/jcb.201804132. 10.1083/jcb.201804132 PubMed 30093494