Skip to main content
Addgene

pMXsIP GFP-VMP1
(Plasmid #117417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXsIP
  • Backbone manufacturer
    Dr.Toshio Kitamura of the University of Tokyo
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VMP1
  • Species
    H. sapiens (human)
  • Entrez Gene
    VMP1 (a.k.a. EPG3, TANGO5, TMEM49)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXsIP GFP-VMP1 was a gift from Noboru Mizushima (Addgene plasmid # 117417 ; http://n2t.net/addgene:117417 ; RRID:Addgene_117417)
  • For your References section:

    Genome-wide CRISPR screen identifies TMEM41B as a gene required for autophagosome formation. Morita K, Hama Y, Izume T, Tamura N, Ueno T, Yamashita Y, Sakamaki Y, Mimura K, Morishita H, Shihoya W, Nureki O, Mano H, Mizushima N. J Cell Biol. 2018 Aug 9. pii: jcb.201804132. doi: 10.1083/jcb.201804132. 10.1083/jcb.201804132 PubMed 30093494