pPD_Pinx-1::ChR2(H134R)::mCherry
(Plasmid
#117420)
-
PurposeFor selectively expressing ChR2(H134R) in AiB interneurons under the expression of a inx-1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPD95.75
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namechannel rhodopsin-2 with H134R mutation
-
Alt nameChR2(H134R)
-
Alt nameChR2/H134R
-
Insert Size (bp)930
-
MutationH134R
- Promoter inx-1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tgagcagccactctgcatagcgc
- 3′ sequencing primer GGCAACCGGCTATGTTAAAGTCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPD_Pinx-1::ChR2(H134R)::mCherry was a gift from Shohei Mitani (Addgene plasmid # 117420 ; http://n2t.net/addgene:117420 ; RRID:Addgene_117420) -
For your References section:
OFF-responses of interneurons optimize avoidance behaviors depending on stimulus strength via electrical synapses. Hori S, Oda S, Suehiro Y, Iino Y, Mitani S. PLoS Genet. 2018 Jun 25;14(6):e1007477. doi: 10.1371/journal.pgen.1007477. eCollection 2018 Jun. PGENETICS-D-17-02446 [pii] PubMed 29939997