Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPD_Pinx-1::ChR2(H134R)::mCherry
(Plasmid #117420)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117420 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPD95.75
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    channel rhodopsin-2 with H134R mutation
  • Alt name
    ChR2(H134R)
  • Alt name
    ChR2/H134R
  • Insert Size (bp)
    930
  • Mutation
    H134R
  • Promoter inx-1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tgagcagccactctgcatagcgc
  • 3′ sequencing primer GGCAACCGGCTATGTTAAAGTCATC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPD_Pinx-1::ChR2(H134R)::mCherry was a gift from Shohei Mitani (Addgene plasmid # 117420 ; http://n2t.net/addgene:117420 ; RRID:Addgene_117420)
  • For your References section:

    OFF-responses of interneurons optimize avoidance behaviors depending on stimulus strength via electrical synapses. Hori S, Oda S, Suehiro Y, Iino Y, Mitani S. PLoS Genet. 2018 Jun 25;14(6):e1007477. doi: 10.1371/journal.pgen.1007477. eCollection 2018 Jun. PGENETICS-D-17-02446 [pii] PubMed 29939997