pMO9075
(Plasmid
#117481)
-
Purposeempty complementation vector for Desulfovibrio: contains promoter from Aph(3')-IIa but no RBS, contains pBG1 and pMB1 replicons, SpecR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR8/GW/TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2817
- Total vector size (bp) 4836
-
Modifications to backbonepCR8/GW/TOPO + pBG1 (PCR product) => pMO719 || pMO719 (EcoRV digested) + kanR (PCR product from pCR-XL-TOPO) => pMO9071 || pMO9071 (BsaBI digest, religate) => pMO9072 || pMO9072 (HpaI/XmnI digest, religate) => pMO9072-1a || pMO9072-1a (EcoRV/BspEI digest, blunted, religated) => pMO9073 || pMO9073 (EcoRI digest, religate) => pMO9075
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsStable in Desulfovibrio vulgaris Hildenborough (low copy number). Use spectinomycin at 100 ug/ml. Promoter for exogenous expression of genes is strong, but is lacking a ribosomal binding site. See primers listed in Korte et al. (2014) for complementation of rex (primers SLIC DVU0916-comp-F and SLIC DVU0916-comp-R) for suggested primers.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAph(3')-IIa promoter
-
Alt namePaph
-
Alt namePkan
-
SpeciesEscherichia coli
-
Insert Size (bp)50
-
GenBank IDNC_008460.1
- Promoter Aph(3')-IIa promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Blunt-end cloned (destroyed during cloning)
- 3′ cloning site Blunt-end cloned (destroyed during cloning)
- 5′ sequencing primer AGACACGGGCCAGAGCTG
- 3′ sequencing primer GCTGAAAGCGAGAAGAGCGCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMO9075 was a gift from Judy Wall (Addgene plasmid # 117481 ; http://n2t.net/addgene:117481 ; RRID:Addgene_117481) -
For your References section:
Methods for engineering sulfate reducing bacteria of the genus Desulfovibrio. Keller KL, Wall JD, Chhabra S. Methods Enzymol. 2011;497:503-17. doi: 10.1016/B978-0-12-385075-1.00022-6. 10.1016/B978-0-12-385075-1.00022-6 PubMed 21601101