Kif1A(1-489)-DHFR-myc
(Plasmid #117833)

• Purpose: Constitutively active Kinesin-3 motor tagged with DHFR and myc
• Depositing Lab: Thomas Schwarz
• Publication: Gutnick et al Nat Cell Biol. 2019 Jun;21(6):768-777. doi: 10.1038/s41556-019-0317-2. Epub 2019 May 6.

Backbone

• Vector backbone: pcDNA3.1(+)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kif1A (1-489)
• Alt name: Kinesin-3 motor domain
• Species: M. musculus (mouse)
• Insert Size (bp): 1467
• Mutation: only aa 1-489 (motor domain)
• GenBank ID: XP_006529221.1
• Entrez Gene: Kif1a (a.k.a. A, ATSV, C630002N23Rik, Gm1626, Kn, Kns1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • DHFR (C terminal on insert)
  • myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CMV_fwd (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: BGH_rev (TAGAAGGCACAGTCGAGG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS results found S33N and E170G variants in Kif1A compared to the NCBI reference [XP_006529221.1]. These variants do not affect plasmid function.