Skip to main content

CHL1 wt-eGFP
(Plasmid #117876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117876 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPICZc
  • Backbone size w/o insert (bp) 3329
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHL1 wt-eGFP
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    AT5G40090 (a.k.a. AT5G40090, CHL1, CHS1-like 1, MUD12.70, MUD12_70)
  • Promoter AOX

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTGGTTCCAATTGACAAGC
  • 3′ sequencing primer GCAAATGGCATTCTGACATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CHL1 wt-eGFP was a gift from Geoffrey Chang (Addgene plasmid # 117876 ; http://n2t.net/addgene:117876 ; RRID:Addgene_117876)