Skip to main content
Addgene

pN_35S/mCitrine/P_UBQ10/Derlin1-mOrange2
(Plasmid #118000)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118000 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pN_35S/mCitrine (Addgene plasmid 117993)
  • Backbone size w/o insert (bp) 2028
  • Total vector size (bp) 12373
  • Modifications to backbone
    Added A. thaliana ubiquitin 10 promoter (P_UBQ10) and nosT terminator (nosT) to backbone. Insert resides between UBQ10 and nosT.
  • Vector type
    Plant Expression ; Plant/bacteria binary vector
  • Selectable markers
    Nourseothricin/streptothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Derlin1-mOrange2
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    1521
  • Promoter Ubiquitin-10

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGTTTCTAGTTTGTGCGATCG
  • 3′ sequencing primer TCATCGCAAGACCGGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The mOrange2 coding sequence was obtained from mOrange2-pBAD (a gift from Michael Davidson & Nathan Shaner & Roger Tsien, Addgene plasmid # 54531)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN_35S/mCitrine/P_UBQ10/Derlin1-mOrange2 was a gift from Mathias Pribil (Addgene plasmid # 118000 ; http://n2t.net/addgene:118000 ; RRID:Addgene_118000)
  • For your References section:

    Membrane-bound protein scaffolding in diverse hosts using thylakoid protein CURT1A. Behrendorff JBYH, Sandoval-Ibanez OA, Sharma A, Pribil M. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418. 10.1021/acssynbio.8b00418 PubMed 30884945