Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXPR003-sgTP53-5
(Plasmid #118023)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118023 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXPR003
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 9482
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgTP53-5
  • gRNA/shRNA sequence
    CATGTGTAACAGTTCCTGCA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    100
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer hU6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

High efficiency of TP53 deletion

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR003-sgTP53-5 was a gift from William Hahn & David Root (Addgene plasmid # 118023 ; http://n2t.net/addgene:118023 ; RRID:Addgene_118023)
  • For your References section:

    Mutational processes shape the landscape of TP53 mutations in human cancer. Giacomelli AO, Yang X, Lintner RE, McFarland JM, Duby M, Kim J, Howard TP, Takeda DY, Ly SH, Kim E, Gannon HS, Hurhula B, Sharpe T, Goodale A, Fritchman B, Steelman S, Vazquez F, Tsherniak A, Aguirre AJ, Doench JG, Piccioni F, Roberts CWM, Meyerson M, Getz G, Johannessen CM, Root DE, Hahn WC. Nat Genet. 2018 Oct;50(10):1381-1387. doi: 10.1038/s41588-018-0204-y. 10.1038/s41588-018-0204-y PubMed 30224644