pMST-711
(Plasmid
#118079)
-
PurposepmbfA::gRNA2(cexA)::ttrpC
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMST665
-
Backbone manufacturerSarkari et al. 2017
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA2 (CexA)
-
SpeciesA. niger
-
Insert Size (bp)246
- Promoter pmbfA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTGCCACTTTTTCAAGTTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMST-711 was a gift from Michael Sauer (Addgene plasmid # 118079 ; http://n2t.net/addgene:118079 ; RRID:Addgene_118079) -
For your References section:
Engineering of the citrate exporter protein enables high citric acid production in Aspergillus niger. Steiger MG, Rassinger A, Mattanovich D, Sauer M. Metab Eng. 2019 Mar;52:224-231. doi: 10.1016/j.ymben.2018.12.004. Epub 2018 Dec 13. 10.1016/j.ymben.2018.12.004 PubMed 30553933