Skip to main content

Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide1
(Plasmid #118173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118173 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR
  • Backbone manufacturer
    Jorge Ferrer
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAB-dCas9-2A-BlastR
  • gRNA/shRNA sequence
    GGATGTGTGTGCGGCCGCGA
  • Species
    H. sapiens (human)
  • Promoter hPGK and U6
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (destroyed during cloning)
  • 3′ cloning site Unknown (destroyed during cloning)
  • 5′ sequencing primer GATCCGCCACCATGGATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/08/27/400291 for bioRxiv preprint.

Note: Plasmid contains a N1396S mutation in dCas9. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide1 was a gift from Jorge Ferrer (Addgene plasmid # 118173 ; http://n2t.net/addgene:118173 ; RRID:Addgene_118173)
  • For your References section:

    Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Miguel-Escalada I, Bonas-Guarch S, Cebola I, Ponsa-Cobas J, Mendieta-Esteban J, Atla G, Javierre BM, Rolando DMY, Farabella I, Morgan CC, Garcia-Hurtado J, Beucher A, Moran I, Pasquali L, Ramos-Rodriguez M, Appel EVR, Linneberg A, Gjesing AP, Witte DR, Pedersen O, Grarup N, Ravassard P, Torrents D, Mercader JM, Piemonti L, Berney T, de Koning EJP, Kerr-Conte J, Pattou F, Fedko IO, Groop L, Prokopenko I, Hansen T, Marti-Renom MA, Fraser P, Ferrer J. Nat Genet. 2019 Jun 28. pii: 10.1038/s41588-019-0457-0. doi: 10.1038/s41588-019-0457-0. 10.1038/s41588-019-0457-0 PubMed 31253982