lentiSAMv2 rs11257655-guide2
(Plasmid
#118205)
-
PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs11257655 (CDC123/CAMK1D GWAS locus)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiSAMv2
-
Backbone manufacturerFeng Zhang (Addgene #75112)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VP64-2A-BlastR
-
gRNA/shRNA sequenceGTAGACACTTGCCCCGAGTC
-
SpeciesH. sapiens (human)
- Promoter EF1a core and U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (destroyed during cloning)
- 3′ cloning site Unknown (destroyed during cloning)
- 5′ sequencing primer GATCCGCCACCATGGATGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/08/27/400291 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiSAMv2 rs11257655-guide2 was a gift from Jorge Ferrer (Addgene plasmid # 118205 ; http://n2t.net/addgene:118205 ; RRID:Addgene_118205) -
For your References section:
Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Miguel-Escalada I, Bonas-Guarch S, Cebola I, Ponsa-Cobas J, Mendieta-Esteban J, Atla G, Javierre BM, Rolando DMY, Farabella I, Morgan CC, Garcia-Hurtado J, Beucher A, Moran I, Pasquali L, Ramos-Rodriguez M, Appel EVR, Linneberg A, Gjesing AP, Witte DR, Pedersen O, Grarup N, Ravassard P, Torrents D, Mercader JM, Piemonti L, Berney T, de Koning EJP, Kerr-Conte J, Pattou F, Fedko IO, Groop L, Prokopenko I, Hansen T, Marti-Renom MA, Fraser P, Ferrer J. Nat Genet. 2019 Jun 28. pii: 10.1038/s41588-019-0457-0. doi: 10.1038/s41588-019-0457-0. 10.1038/s41588-019-0457-0 PubMed 31253982