Skip to main content
Addgene

pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
(Plasmid #118273)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118273 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Ef1a-fDIO EYFP
  • Backbone manufacturer
    K. Deisseroth lab (Stanford)
  • Modifications to backbone
    The EYFP gene was replaced with GCaMP6f
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Alt name
    GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • Promoter EF1a
  • Tags / Fusion Proteins
    • 6xHis (N terminal on insert) (N terminal on insert)
    • T7 epitope (N terminal on insert)
    • Xpress tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer gttgcgtgagcggaaagatg
  • 3′ sequencing primer ggcattaaagcagcgtatccac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6f is cloned from pGP-CMV-GCaMP6f (Addgene#40755) provided by Douglas Kim. Backbone is derived from pAAV-Ef1a-fDIO EYFP (Addgene#55641) provided by Karl Deisseroth.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE was a gift from Naoshige Uchida (Addgene plasmid # 118273 ; http://n2t.net/addgene:118273 ; RRID:Addgene_118273)
  • For your References section:

    Dopamine neurons projecting to the posterior striatum reinforce avoidance of threatening stimuli. Menegas W, Akiti K, Amo R, Uchida N, Watabe-Uchida M. Nat Neurosci. 2018 Sep 3. pii: 10.1038/s41593-018-0222-1. doi: 10.1038/s41593-018-0222-1. 10.1038/s41593-018-0222-1 [pii] PubMed 30177795