Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #118273)


Item Catalog # Description Quantity Price (USD)
Plasmid 118273 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pAAV-Ef1a-fDIO EYFP
  • Backbone manufacturer
    K. Deisseroth lab (Stanford)
  • Modifications to backbone
    The EYFP gene was replaced with GCaMP6f
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • Promoter EF1a
  • Tags / Fusion Proteins
    • 6xHis (N terminal on insert) (N terminal on insert)
    • T7 epitope (N terminal on insert)
    • Xpress tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer gttgcgtgagcggaaagatg
  • 3′ sequencing primer ggcattaaagcagcgtatccac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6f is cloned from pGP-CMV-GCaMP6f (Addgene#40755) provided by Douglas Kim. Backbone is derived from pAAV-Ef1a-fDIO EYFP (Addgene#55641) provided by Karl Deisseroth.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE was a gift from Naoshige Uchida (Addgene plasmid # 118273 ; ; RRID:Addgene_118273)
  • For your References section:

    Dopamine neurons projecting to the posterior striatum reinforce avoidance of threatening stimuli. Menegas W, Akiti K, Amo R, Uchida N, Watabe-Uchida M. Nat Neurosci. 2018 Sep 3. pii: 10.1038/s41593-018-0222-1. doi: 10.1038/s41593-018-0222-1. 10.1038/s41593-018-0222-1 [pii] PubMed 30177795