pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE
(Plasmid
#118274)
-
PurposeExpresses the SthK channel & bPAC(WT)-mCherry under a minimal CamKII promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneCW3SL
-
Backbone manufacturerBong-Kiun Kaang
- Backbone size w/o insert (bp) 3771
- Total vector size (bp) 7002
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namebPAC(WT)
-
Alt namephotoactivated adenylyl cyclase from Beggiatoa sp.
-
SpeciesBeggiatoa sp.
-
Insert Size (bp)1055
-
GenBank ID
- Promoter CamK II
-
Tags
/ Fusion Proteins
- myc tag (C terminal on insert)
- His tag (C terminal on insert)
- mCherry (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGAGCTACTAACTTCAGCC
- 3′ sequencing primer CGTATCCACATAGCGTAAAAGGAGCAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSthK
-
SpeciesSpirochaeta thermophila
-
GenBank IDYP_003873862.1
- Promoter CamK II
-
Tag
/ Fusion Protein
- P2A (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTCTCCGTTTGCACTCAGGA
- 3′ sequencing primer GGGTTCTCCTCCACGTCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118274 ; http://n2t.net/addgene:118274 ; RRID:Addgene_118274) -
For your References section:
Potassium channel-based optogenetic silencing. Bernal Sierra YA, Rost BR, Pofahl M, Fernandes AM, Kopton RA, Moser S, Holtkamp D, Masala N, Beed P, Tukker JJ, Oldani S, Bonigk W, Kohl P, Baier H, Schneider-Warme F, Hegemann P, Beck H, Seifert R, Schmitz D. Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8. 10.1038/s41467-018-07038-8 PubMed 30397200