Skip to main content

mCherry-Rap2b
(Plasmid #118320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118320 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 118320-D50 50 μg of DNA in Tris buffer $495
DNA 118320-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    mCherry-C1
  • Backbone manufacturer
    clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rap2b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    555
  • Entrez Gene
    RAP2B
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer mCherry-C:gcgcctacaacgtcaacatcaag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

human Rap2b was purchased from the Missouri S&T cDNA resouce center

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-Rap2b was a gift from Philip Stork (Addgene plasmid # 118320 ; http://n2t.net/addgene:118320 ; RRID:Addgene_118320)
  • For your References section:

    The interaction of Epac1 and Ran promotes Rap1 activation at the nuclear envelope. Liu C, Takahashi M, Li Y, Dillon TJ, Kaech S, Stork PJ. Mol Cell Biol. 2010 Aug;30(16):3956-69. doi: 10.1128/MCB.00242-10. Epub 2010 Jun 14. 10.1128/MCB.00242-10 PubMed 20547757