mCherry-Rap2b
(Plasmid
#118320)
-
PurposeExpression of human Rap2b
-
Depositing Lab
-
Depositing OrganizationOregon Health & Science University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 118320-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 118320-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonemCherry-C1
-
Backbone manufacturerclontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRap2b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)555
-
Entrez GeneRAP2B
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer mCherry-C:gcgcctacaacgtcaacatcaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
human Rap2b was purchased from the Missouri S&T cDNA resouce center
DNA (Catalog # 118320-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 118320-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-Rap2b was a gift from Philip Stork (Addgene plasmid # 118320 ; http://n2t.net/addgene:118320 ; RRID:Addgene_118320) -
For your References section:
The interaction of Epac1 and Ran promotes Rap1 activation at the nuclear envelope. Liu C, Takahashi M, Li Y, Dillon TJ, Kaech S, Stork PJ. Mol Cell Biol. 2010 Aug;30(16):3956-69. doi: 10.1128/MCB.00242-10. Epub 2010 Jun 14. 10.1128/MCB.00242-10 PubMed 20547757