p221z-AtMIR390a
(Plasmid
#118388)
-
PurposeEntry clone containing AtMIR390a backbone (split by ccdB gene). Used to make artificial microRNA construct. For use in plants and compatible with the MultiSite Gateway system.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118388 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR-221z
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtMIR390a backbone
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13 Forward (-20) gtaaaacgacggccag
- 3′ sequencing primer T7 universal primer, taatacgactcactataggg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p221z-AtMIR390a was a gift from Ari Pekka Mähönen (Addgene plasmid # 118388 ; http://n2t.net/addgene:118388 ; RRID:Addgene_118388) -
For your References section:
An inducible genome editing system for plants. Wang X, Ye L, Lyu M, Ursache R, Loytynoja A, Mahonen AP. Nat Plants. 2020 Jun 29. pii: 10.1038/s41477-020-0695-2. doi: 10.1038/s41477-020-0695-2. 10.1038/s41477-020-0695-2 PubMed 32601420