Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LentiCRISPRv2-sgSORCS2-G2
(Plasmid #118416)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118416 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #52961
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA SORCS2 Human
  • gRNA/shRNA sequence
    GCCGCGGCACCCGGGTCAGTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    SORCS2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-sgSORCS2-G2 was a gift from Mark Denham (Addgene plasmid # 118416 ; http://n2t.net/addgene:118416 ; RRID:Addgene_118416)
  • For your References section:

    A Modified Monomeric Red Fluorescent Protein Reporter for Assessing CRISPR Activity. Hojland Knudsen C, Asgrimsdottir ES, Rahimi K, Gill KP, Frandsen S, Hvolbol Buchholdt S, Chen M, Kjems J, Febbraro F, Denham M. Front Cell Dev Biol. 2018 May 15;6:54. doi: 10.3389/fcell.2018.00054. eCollection 2018. 10.3389/fcell.2018.00054 PubMed 29868584