LentiCRISPRv2-sgSORCS2-G2
(Plasmid
#118416)
-
PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang, Addgene plasmid #52961
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA SORCS2 Human
-
gRNA/shRNA sequenceGCCGCGGCACCCGGGTCAGTT
-
SpeciesH. sapiens (human)
-
Entrez GeneSORCS2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2-sgSORCS2-G2 was a gift from Mark Denham (Addgene plasmid # 118416 ; http://n2t.net/addgene:118416 ; RRID:Addgene_118416) -
For your References section:
A Modified Monomeric Red Fluorescent Protein Reporter for Assessing CRISPR Activity. Hojland Knudsen C, Asgrimsdottir ES, Rahimi K, Gill KP, Frandsen S, Hvolbol Buchholdt S, Chen M, Kjems J, Febbraro F, Denham M. Front Cell Dev Biol. 2018 May 15;6:54. doi: 10.3389/fcell.2018.00054. eCollection 2018. 10.3389/fcell.2018.00054 PubMed 29868584