pDRF1-GW yosfGFP-T2A-mCherry
(Plasmid
#118448)
-
PurposeProduces equimolar expression of yeast codon-optimized sfGFP and mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDRF1-GW
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyosfGFP-T2A-mCherry
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer AACAATCGTTAATAATTAATTAATTGG
- 3′ sequencing primer GAGTCACTTTAAAATTTGTATACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRF1-GW yosfGFP-T2A-mCherry was a gift from Bas Teusink (Addgene plasmid # 118448 ; http://n2t.net/addgene:118448 ; RRID:Addgene_118448) -
For your References section:
In vivo characterisation of fluorescent proteins in budding yeast. Botman D, de Groot DH, Schmidt P, Goedhart J, Teusink B. Sci Rep. 2019 Feb 19;9(1):2234. doi: 10.1038/s41598-019-38913-z. 10.1038/s41598-019-38913-z PubMed 30783202